b longum infantis atcc 15697 Search Results


93
ATCC kribbella flavida dsm 17836
Kribbella Flavida Dsm 17836, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b+longum+infantis+atcc+15697/us08685392-140-59-92?v=ATCC
Average 93 stars, based on 1 article reviews
kribbella flavida dsm 17836 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

98
ATCC l casei atcc393
L Casei Atcc393, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b+longum+infantis+atcc+15697/pmc07096272-82-103-108?v=ATCC
Average 98 stars, based on 1 article reviews
l casei atcc393 - by Bioz Stars, 2026-07
98/100 stars
  Buy from Supplier

99
Thermo Fisher phusion dna polymerase
Phusion Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b+longum+infantis+atcc+15697/pmc03593662-72-22-25?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
phusion dna polymerase - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

90
ATCC clostridium novyi atcc 7658
Clostridium Novyi Atcc 7658, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b+longum+infantis+atcc+15697/pm15668012-54-72-74?v=ATCC
Average 90 stars, based on 1 article reviews
clostridium novyi atcc 7658 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

96
ATCC lactobacillus acidophilus ncfm
Lactobacillus Acidophilus Ncfm, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b+longum+infantis+atcc+15697/us08697054-59-168-183?v=ATCC
Average 96 stars, based on 1 article reviews
lactobacillus acidophilus ncfm - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

95
ATCC b animalis atcc 25527
B Animalis Atcc 25527, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b+longum+infantis+atcc+15697/pmc00165193-83-8-10?v=ATCC
Average 95 stars, based on 1 article reviews
b animalis atcc 25527 - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

93
ATCC bacteroides eggerthii
Bacteroides Eggerthii, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b+longum+infantis+atcc+15697/pmc00101487-78-23-25?v=ATCC
Average 93 stars, based on 1 article reviews
bacteroides eggerthii - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
ATCC b choerinum atcc 27686 t
B Choerinum Atcc 27686 T, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b+longum+infantis+atcc+15697/pmc00091600-231-235-237?v=ATCC
Average 93 stars, based on 1 article reviews
b choerinum atcc 27686 t - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

95
ATCC b dentium atcc 27678
B Dentium Atcc 27678, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b+longum+infantis+atcc+15697/pmc02772436-22-8-10?v=ATCC
Average 95 stars, based on 1 article reviews
b dentium atcc 27678 - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

95
DSMZ bifidobacterium species
Bifidobacterium Species, supplied by DSMZ, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b+longum+infantis+atcc+15697/pmc01797147-125-14-27?v=DSMZ
Average 95 stars, based on 1 article reviews
bifidobacterium species - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

99
ATCC fragilis 9343 seq id fkp r cattacgtttaaacttatgatcgtgatacttggaa pmei atcc 25285 no
Fragilis 9343 Seq Id Fkp R Cattacgtttaaacttatgatcgtgatacttggaa Pmei Atcc 25285 No, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b+longum+infantis+atcc+15697/us09340812-615-141-148?v=ATCC
Average 99 stars, based on 1 article reviews
fragilis 9343 seq id fkp r cattacgtttaaacttatgatcgtgatacttggaa pmei atcc 25285 no - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

94
ATCC brucella suis atcc 23445 nc 010169
Brucella Suis Atcc 23445 Nc 010169, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b+longum+infantis+atcc+15697/pmc05993296__pgen__1007421__s006-19-66-68?v=ATCC
Average 94 stars, based on 1 article reviews
brucella suis atcc 23445 nc 010169 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

Image Search Results